QIAseq miRNA Library Kit

Gel-free miRNA Sample to Insight solution for differential expression analysis and novel discovery using next-generation sequencing

Features

  • Gel-free miRNA sequencing library prep from as little as 1 ng of total RNA
  • Elimination of adapter dimers and unwanted RNA species resulting in the highest fidelity and most efficient data
  • Bead-based method to remove adapter dimers and unwanted RNA species
  • Integrated Unique Molecular Indices (UMIs) enable quantification of individual miRNA molecules
  • Includes access to the RNA-seq Analysis Portal for human, mouse and rat samples
undefined

✓ 24/7 automatic processing of online orders

✓ Knowledgeable and professional Product & Technical Support

✓ Fast and reliable (re)-ordering

QIAseq miRNA Library Kit (12)

Cat. No. / ID: 331502

For 12 sequencing prep reactions: 3’ ligation, 5’ ligation, reverse-transcription, cDNA cleanup, library amplification and library cleanup reagents; quality control primers
$1,223.00
KitIndex
Library Kit
miRNA Index Kit
Reactions
12
96
Add to cart
The QIAseq miRNA Library Kit is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease.

✓ 24/7 automatic processing of online orders

✓ Knowledgeable and professional Product & Technical Support

✓ Fast and reliable (re)-ordering

Product Details

Optimized reaction chemistry enables robust, miRNA-specific libraries while minimizing reaction biases and eliminating adapter dimers. Unique Molecular Indices (UMIs) tag each miRNA at an early stage, eliminating PCR and sequencing bias. Analyze stranded RNA-seq data with ease using the GeneGlobe-integrated RNA-seq Analysis Portal – an intuitive, web-based data analysis solution created for biologists and included with QIAseq Stranded RNA Library Kits.

Want to try this solution for the first time? Request a quote for a trial kit.

Performance

QIAseq miRNA sequencing enables superior data generation through an improved workflow. The standard QIAseq miRNA procedure does not require gel purification, excision and elution, providing substantial sample handling/loss and time savings.

A huge issue with miRNA sequencing workflows is the presence of adapter dimer contamination. The QIAseq miRNA Library Kit has fully optimized library process to virtually eliminate adapter dimerization, even from very low inputs of total RNA (see figure Adapter dimers (AD) and contaminating RNA steal your reads during miRNAseq experiments). In addition, the reaction chemistry facilitates the preparation of robust, miRNA-focused libraries while all but eliminating biases and background contaminants. Together, these benefits highlight that the QIAseq miRNA Library Kit is designed to maximize the yield of miRNA available to sequence.

Due to the growth of circulating miRNAs as potential biomarkers, the QIAseq miRNA Library Kit is optimized to map miRNA down to ultralow input levels. In addition, the kit integrates Unique Molecular Indices (UMIs) into the reverse-transcription process, enabling unbiased and accurate miRNome-wide quantification of mature miRNAs by NGS. Collectively,  QIAseq miRNA offers an unrivaled Sample to Insight solution for differential expression analysis and discovery of novel miRNAs using next-generation sequencing (see figure QIAseq miRNA workflow).

Principle

Mature miRNAs are naturally occurring, 22-nucleotide, non-coding RNAs that mediate posttranscriptional gene regulation. Alterations in miRNA can be correlated with gene expression changes in development, differentiation, signal transduction, infection, aging and disease. Continually growing evidence associates circulating miRNA expression with both normal and disease biology as miRNAs expressed in virtually all biofluids, including serum, plasma, cerebrospinal fluid (CSF) and urine. Specifically with cancers, numerous studies and reviews have associated the presence of various miRNAs with cancer cell proliferation, resistance to apoptosis, invasiveness and differentiation.

Quantification of miRNA expression can be performed using a variety of technologies including next-generation sequencing (NGS) and real-time PCR (qPCR). While NGS is the default tool for novel miRNA discovery, commercially available library preparation kits are tedious and introduce biases. As a result, qPCR has been the “go to” technology for quantification of miRNA expression, until now. QIAseq miRNA defines a new generation in small RNA sequencing products and includes several distinct features not found in other sequencing kits. With the QIAseq miRNA Library Kit, the power of NGS has been combined with single molecule quantification from UMIs to produce the most representative expression data possible.

Procedure

QIAGEN offers a true Sample to Insight workflow, from sample isolation to data analysis and interpretation. Total RNA is first extracted from biofluids (such as serum, plasma, CSF and urine), cells, fresh/frozen tissues or FFPE tissues using a miRNeasy kit. From there, miRNA sequencing libraries are prepared using the QIAseq miRNA Library Kit (see figure Under a day prep).

In an unbiased reaction, adapters are ligated sequentially to the 3’ and 5’ ends of miRNAs. Subsequently, universal cDNA synthesis with UMI assignment, cDNA cleanup, library amplification and library cleanup are performed. Proprietary methodology, using modified oligonucleotides, virtually eliminates the presence of adapter dimers in the sequencing library and effectively removes a major contaminant often observed during sequencing. Bead-based cleanups eliminate the majority of unwanted background noise that steals sequencing reads from a budget. The UMIs ensure that during data analysis, the sample is analyzed specifically, not amplification or sequencing artifacts. To go from sample to sequencer, the process takes only eight hours, with minimal hands-on time. Up to a maximum of 48 samples can be multiplexed.

After sequencing, “.fastq” or “.fastq.gz” file formats can be uploaded directly to the GeneGlobe Data Analysis Center for primary mapping and molecular tag counting. For well-characterized species, such as human, mouse and rat, reads are mapped to species-specific miRBase and genome databases. For poorly-characterized or novel species, read are mapped to the entire miRBase database. Secondary differential expression analysis is then performed with multiple methods for molecular tag count normalization and visualization of the resulting data.

Applications

Biofluids (such as serum, plasma, CSF and urine), cells, fresh/frozen tissue and FFPE tissues containing total and miRNA are compatible with the QIAseq miRNA Library Kit. Use the QIAseq miRNA to characterize the next circulating miRNA biomarker. Uncover miRNA signatures locked away in FFPE tissues. Completely characterize a new species. The QIAseq miRNA Library Kit has been designed to enhance yields from biofluids such as serum. In the figure Detection of miRNA, the QIAseq miRNA Library Kit shows robust detection of miRNA from serum samples. Mapped reads were then compared to adapter dimers in serum samples. QIAseq miRNA still shows superior mapping of miRNAs even with limited samples (see figure Read distribution in serum samples). With the QIAseq miRNA Library Kit, determine the differential expression of any known or novel miRNAs from any total RNA sample derived from any species.

QIAseq miRNA is the ultimate tool to enhance discovery and expression from large-scale projects with hundreds of samples down to the small pilot focused on a group of target miRNA. QIAseq miRNA offers an unrivaled Sample to Insight solution for differential expression analysis and discovery of novel miRNAs using next-generation sequencing.

Supporting data and figures

Resources

Quick-Start Protocols (4)
Part 3b: Library amplification using tube indices
Part 2: QIAseq miRNA NGS (QMN) Bead preparation, cDNA cleanup
Part 1: 3' Ligation, 5' ligation, reverse transcription
Part 3a: Library amplification using HT plate indices
Scientific Posters (1)
Poster for download
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Kit Handbooks (3)
Precision small RNA library prep for Thermo Fisher Scientific® NGS systems
Precision small RNA library prep for Illumina® NGS systems

FAQ

What is the recommended read length for libraries prepared using the QIAseq miRNA Library Kit?
The recommended protocol suggests a 75 bp single read. “FASTQ Only” should be selected, with “TruSeq Small RNA” chosen from the Sample Prep Kit dropdown menu. 

FAQ ID - 3668
Can you perform qPCR analysis of miRNAs from libraries prepared with the QIAseq miRNA Library Kit?
No, this is not advised. The miScript PCR System should be used for qPCR analysis of miRNAs instead.
FAQ ID - 3674
Total RNA from what sample types are compatible with the QIAseq miRNA Library Kit?
Total RNA from cells, fresh/frozen tissue, FFPE tissue, serum/plasma, bloods and other fluids are compatible with the QIAseq miRNA Library Kit.
FAQ ID - 3660
What method is used to eliminate adapter dimers from the QIAseq miRNA library?
Proprietary technology utilizing modified oligonucleotides is used to eliminate the reverse-transcription of adapter dimers.

FAQ ID - 3667
Are any components of the QIAseq miRNA Library Kit interchangeable with components from other QIAGEN kits?
No. The components of the QIAseq miRNA Library Kit are not interchangeable with components from any other QIAGEN kits
FAQ ID - 3662
Should total RNA or small enriched RNA be used as the starting material for the QIAseq miRNA Library Kit?
Total RNA containing miRNA is the required starting material for the QIAseq miRNA Library Kit. It is not necessary to enrich for small RNA
FAQ ID - 3659
What is the sequence of the QIAseq miRNA NGS 5’ Adapter?
When inputting the adapter sequence for adapter trimming, the following DNA sequence should be used:

(5’–3')  GTTCAGAGTTCTACAGTCCGACGATC
FAQ ID - 3672
What is the maximum number of available sample indexes?
The maximum number of sample indexes is 48.
FAQ ID - 3665
What can be used to validate results obtained with the QIAseq miRNA Sequencing System?
The miScript PCR System can be used to validate results obtained with the QIAseq miRNA Sequencing System.
FAQ ID - 3675
What is the acceptable number of reads per sample per miRNA sequencing run?

For routine miRNA expression analysis from cell and tissue samples, 1–2M mapped reads is acceptable. For discovery applications, or sequencing from biofluids, 10–20M reads is acceptable.  


FAQ ID - 3673
How do Unique Molecular Indexes (UMIs) improve quantification?
During the QIAseq miRNA Library Kit library construction process, each individual miRNA molecule is tagged with a UMI. Following sequencing, raw reads are mapped to individual miRNA molecules instead of just individual miRNAs. This allows for true quantification of the miRNAs by eliminating any library amplification and sequencing bias.
FAQ ID - 3669
What are recommended stopping points during the QIAseq miRNA Library Kit procedure?
If the workflow is not expected to be completed in one day, convenient stopping points are indicated at the end of particular sections, including Protocol: cDNA Cleanup, Protocol: Library Amplification and Protocol: Library Cleanup.
FAQ ID - 3663
Does a QIAseq miRNA library include hY4 Y RNA?
No, the QIAseq miRNA Library Kit is designed to minimize the presence of hY4 Y RNA in the sequencing library

FAQ ID - 3670
Can I still perform sequencing if my miRNA sequencing library concentrations are too low to obtain a 4 nM library?
Yes. If Library QC suggests that the library is of good quality and simply low in concentration, it can still be used for sequencing. It is possible to either sequence the library at 2nM or otherwise at the maximum amount available for that library (either individually or in multiplex with other samples). It is recommended to  keep all libraries being multiplexed at comparable concentrations


FAQ ID - 3666
When multiplexing samples, what sample indexes should be combined?
Please refer to the Illumina® TruSeq® Library Prep Pooling Guide available through http://support.illumina.com.
FAQ ID - 3664
Can miRNA sequencing libraries be prepared from total RNA isolated from heparinized plasma samples?
Heparin is a potent reverse-transcription inhibitor. After total RNA isolation from heparinized plasma samples, the heparin must be removed. One option is to treat the total RNA samples with heparinase prior to library construction with the QIAseq miRNA Library Kit. 

FAQ ID - 3661
What is the sequence of the QIAseq miRNA NGS 3’ Adapter?
(5’-3’) AACTGTAGGCACCATCAAT

FAQ ID - 3671